View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5856-15 (Length: 105)
Name: Solexa-NF5856-15
Description: NF5856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5856-15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 1e-35; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 1e-35
Query Start/End: Original strand, 17 - 96
Target Start/End: Complemental strand, 47782768 - 47782689
Alignment:
| Q |
17 |
aaggaagtcataggagagagactattaagagttccacatacttcggtgataggaaatgtattcattgtggtgtcaccctg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
47782768 |
aaggaagtcataggagagagactattaagagttccacatactttggtgataggaaatgtattcattgtggtgtcaccctg |
47782689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University