View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5856-20 (Length: 51)
Name: Solexa-NF5856-20
Description: NF5856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5856-20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 47; Significance: 9e-19; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 47; E-Value: 9e-19
Query Start/End: Original strand, 2 - 48
Target Start/End: Original strand, 44804191 - 44804237
Alignment:
| Q |
2 |
gaccaatggactcagaagaaccttcattctgccaattatgttcatct |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44804191 |
gaccaatggactcagaagaaccttcattctgccaattatgttcatct |
44804237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University