View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5856-8 (Length: 140)
Name: Solexa-NF5856-8
Description: NF5856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5856-8 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 140; Significance: 1e-73; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 1 - 140
Target Start/End: Complemental strand, 32545980 - 32545841
Alignment:
| Q |
1 |
ataggatgggaagtataacttctacccactcaagtgtattcattacccttttctctattcaattttctcttgctttttgcatggtaatgtgttgataatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32545980 |
ataggatgggaagtataacttctacccactcaagtgtattcattacccttttctctattcaattttctcttgctttttgcatggtaatgtgttgataatt |
32545881 |
T |
|
| Q |
101 |
atttagacagataatgaaaactgatgaatgaatgcgaatt |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32545880 |
atttagacagataatgaaaactgatgaatgaatgcgaatt |
32545841 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University