View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5856-9 (Length: 131)
Name: Solexa-NF5856-9
Description: NF5856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5856-9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 102; Significance: 4e-51; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 102; E-Value: 4e-51
Query Start/End: Original strand, 8 - 130
Target Start/End: Original strand, 35719062 - 35719180
Alignment:
| Q |
8 |
gcatatttaaattcatatcttatttggagctagccaatgaaaaaccttagcacggtgttatagaaagtgttcaatgggttggatctcacccttgagttaa |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35719062 |
gcatatttaaattcatatcttatttggagctagccaatgaaaaaccttagcacggtgttatagaaagtgttcaatgggttggatctcacccttgagt--- |
35719158 |
T |
|
| Q |
108 |
cttttgggttactcttctatttg |
130 |
Q |
| |
|
|||||| ||||||||||||||| |
|
|
| T |
35719159 |
-ttttggattactcttctatttg |
35719180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University