View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5858-18 (Length: 126)
Name: Solexa-NF5858-18
Description: NF5858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5858-18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 1e-32; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 1e-32
Query Start/End: Original strand, 11 - 109
Target Start/End: Original strand, 27159098 - 27159196
Alignment:
| Q |
11 |
tcctatgctaaaatttgtgtggaccttaactcaatcttataaaatcgtgaaaaatatgttatatctttcgtccgtagacaaattttgtttaggttatat |
109 |
Q |
| |
|
|||||||||||||||||||| || | ||||||||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
27159098 |
tcctatgctaaaatttgtgtcgaacctaactcaatcttataaaatcgtgaaaaatatgttatatctttcatccaaagataaattttgtttaggttatat |
27159196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University