View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5858-29 (Length: 94)
Name: Solexa-NF5858-29
Description: NF5858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5858-29 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 6e-28; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 6e-28
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 34528525 - 34528434
Alignment:
| Q |
1 |
agagagtgtcagaatgcaaaagagtaatcaaagaaaccatcaaaagaaaactcttatgaagaaactatggttggggatgatctcttcttcttca |
94 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
34528525 |
agagagtgttagaatgcaaaagagtaatcaaagaaaccatc--aacacaactcttatgaagaaactatggttggcgatgatttcttcttcttca |
34528434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University