View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5858-4 (Length: 196)
Name: Solexa-NF5858-4
Description: NF5858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5858-4 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 178; Significance: 3e-96; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 8 - 193
Target Start/End: Original strand, 25731564 - 25731749
Alignment:
| Q |
8 |
ccaacaaaacccagatggcatccttatggaaaccaaaaaataaagtggacatctccttgatggaccataatcgcttcatgttccaattcttcagttatac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25731564 |
ccaacaaaacccagatggcatccttatggaaaccaaaaaataaagtggacatctccttgatggaccataatcgcttcatgttccaattcttcagttatac |
25731663 |
T |
|
| Q |
108 |
ggaaatggaacaaaatgttcaacaaggaccatggatgttcgacaatttccctctaatttggagcaaggtcccggtggggaaagatc |
193 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25731664 |
ggaaagggaacaaaatgttcaacaaggaccatggatgtttgacaatttccctctaatttggagcaaggtcccggtggggaaagatc |
25731749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 82 - 193
Target Start/End: Complemental strand, 16941174 - 16941063
Alignment:
| Q |
82 |
ttcatgttccaattcttcagttatacggaaatggaacaaaatgttcaacaaggaccatggatgttcgacaatttccctctaatttggagcaaggtcccgg |
181 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||||||| || |||||| ||||| || ||| |||| |||||||||| || ||||||| ||| || ||| |
|
|
| T |
16941174 |
ttcatgttccaattcttcagctatgcggacatggaacgaattgttcagcaaggtccgtggctgtttgacaatttcctacttgtttggagtaagatctcgg |
16941075 |
T |
|
| Q |
182 |
tggggaaagatc |
193 |
Q |
| |
|
||||||| |||| |
|
|
| T |
16941074 |
tggggaatgatc |
16941063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University