View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5858-6 (Length: 184)
Name: Solexa-NF5858-6
Description: NF5858
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5858-6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 62; Significance: 5e-27; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 109 - 174
Target Start/End: Complemental strand, 19824073 - 19824008
Alignment:
| Q |
109 |
catcaatgaacaccagctggttagaagataagcagatgtgtcagtgatgtcataaaccccttcatc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19824073 |
catcaatgaacaccagctggttagaagataagcagatgtgtcattgatgtcataaaccccttcatc |
19824008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 7e-20
Query Start/End: Original strand, 16 - 80
Target Start/End: Complemental strand, 19824133 - 19824068
Alignment:
| Q |
16 |
atcatgtttttgtcccttgcaaacatgtttggtt-ttttcatcaagaattgattctaagacatcaa |
80 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
19824133 |
atcatgtttttgtcccttgcaaacatatttggtttttttcatcaagaattgattataagacatcaa |
19824068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 69 - 125
Target Start/End: Complemental strand, 37645289 - 37645233
Alignment:
| Q |
69 |
ctaagacatcaagtaatccatgagttaactttgaccccttcatcaatgaacaccagc |
125 |
Q |
| |
|
|||||||||||| ||| ||| ||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
37645289 |
ctaagacatcaactaacccaggagttaactttgatcccttcatcaatgaagaccagc |
37645233 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 92 - 125
Target Start/End: Complemental strand, 19827190 - 19827157
Alignment:
| Q |
92 |
gttaactttgaccccttcatcaatgaacaccagc |
125 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
19827190 |
gttaactttgaccccttcatcaatgaagaccagc |
19827157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 42; Significance: 0.000000000000004; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 42; E-Value: 0.000000000000004
Query Start/End: Original strand, 21 - 70
Target Start/End: Complemental strand, 16159626 - 16159577
Alignment:
| Q |
21 |
gtttttgtcccttgcaaacatgtttggttttttcatcaagaattgattct |
70 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16159626 |
gtttttgtcccgtgcaaacatttttggttttttcatcaagaattgattct |
16159577 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 22 - 70
Target Start/End: Original strand, 24035660 - 24035708
Alignment:
| Q |
22 |
tttttgtcccttgcaaacatgtttggttttttcatcaagaattgattct |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
24035660 |
tttttgtcccttgcaaacatgtttggttttttcttcaagaatcgattct |
24035708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 21 - 53
Target Start/End: Original strand, 4290569 - 4290601
Alignment:
| Q |
21 |
gtttttgtcccttgcaaacatgtttggtttttt |
53 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
4290569 |
gtttttgtcacttgcaaacatgtttggtttttt |
4290601 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 21 - 70
Target Start/End: Original strand, 21223796 - 21223845
Alignment:
| Q |
21 |
gtttttgtcccttgcaaacatgtttggttttttcatcaagaattgattct |
70 |
Q |
| |
|
|||||||||||||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
21223796 |
gtttttgtcccttgtaaacatgtttggttatttcaccaagaattgattct |
21223845 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University