View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5859-14 (Length: 115)
Name: Solexa-NF5859-14
Description: NF5859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5859-14 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 104; Significance: 2e-52; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 104; E-Value: 2e-52
Query Start/End: Original strand, 4 - 115
Target Start/End: Complemental strand, 31776117 - 31776006
Alignment:
| Q |
4 |
agcataggattcgtaggacaaagtttgataatgagaggaagattgctttcagaaagacaacatatgaagacaaaccaaaaaatccacgtgtcatgctaca |
103 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31776117 |
agcataggattcgtaggacagagtttgataatgagaggaagattgctttcagaaagacaacatatgaagacaaaccaaaaaatccaagtgtcatgctaca |
31776018 |
T |
 |
| Q |
104 |
aaatgagaagtt |
115 |
Q |
| |
|
|||||||||||| |
|
|
| T |
31776017 |
aaatgagaagtt |
31776006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University