View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5859-3 (Length: 147)
Name: Solexa-NF5859-3
Description: NF5859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5859-3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 2e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 8 - 141
Target Start/End: Complemental strand, 31776005 - 31775873
Alignment:
| Q |
8 |
gtggggggcacaaatgcatcaatgtatgtatgttctgggaaaaataagatttttcacttgttactttattttaatttaatgtgctaaccaataatagaac |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31776005 |
gtggggggcacaaatgcatcaatgtatgtatgttctgggaaaa-taagatttttcacttgttactttattttaatttaatgtgctaaccaataatagaac |
31775907 |
T |
 |
| Q |
108 |
cttgaacacagacttacccgtgtgtgttataata |
141 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
31775906 |
cttgaacacagacttacccgtgtgtgttataata |
31775873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University