View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5859-4 (Length: 142)
Name: Solexa-NF5859-4
Description: NF5859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5859-4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 69; Significance: 2e-31; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 69; E-Value: 2e-31
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 35442540 - 35442608
Alignment:
| Q |
1 |
gttgatttaatggttgagatcaaaattgtgttgatttttacaacaccaacatgaagaacattctctctg |
69 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35442540 |
gttgatttaatggttgagatcaaaattgtgttgatttttacaacaccaacatgaagaacattctctctg |
35442608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 3e-18
Query Start/End: Original strand, 92 - 142
Target Start/End: Original strand, 35442632 - 35442682
Alignment:
| Q |
92 |
caacagaggatggagaaggcacttgttattagggctttgaatttactttat |
142 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35442632 |
caacagaggatggagaaggaacttgttattagggctttgaatttactttat |
35442682 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University