View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5859-6 (Length: 140)
Name: Solexa-NF5859-6
Description: NF5859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5859-6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 9e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 9e-68
Query Start/End: Original strand, 3 - 140
Target Start/End: Complemental strand, 47460021 - 47459884
Alignment:
| Q |
3 |
agacaacaaagagaagaagtttccagaaaagggaacaatcatctgaaaatgaagaaaaaataatgttgttcatgggaaatggaggttgaggacggcttgt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47460021 |
agacaacaaagagaagaagtttccagaaaagagaacaatcatctgaaaatgaagaaaaaataatgttgttcacgggaaatggaggttgaggacggcttgt |
47459922 |
T |
|
| Q |
103 |
gctctccgatagaataaaccttttagggttttctctta |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47459921 |
gctctccgatagaataaaccttttagggttttctctta |
47459884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University