View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5859-9 (Length: 136)
Name: Solexa-NF5859-9
Description: NF5859
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5859-9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 103 - 136
Target Start/End: Original strand, 239734 - 239767
Alignment:
| Q |
103 |
gtagcagcagcttggaagagaatgagaacatcag |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
239734 |
gtagcagcagcttggaagagaatgagaacatcag |
239767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University