View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5860-10 (Length: 127)
Name: Solexa-NF5860-10
Description: NF5860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5860-10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 1e-58; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 1e-58
Query Start/End: Original strand, 8 - 123
Target Start/End: Original strand, 27729693 - 27729808
Alignment:
| Q |
8 |
gataacacttgttgtcttggccacatatcctttgataataagtggtcacattgktgaggtagctttctctttcacaccatttaaacattaagaaattaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27729693 |
gataacacttgttgtcttggccacatatcctttgataataagtggtcacattggtgaggtagctttctctttcacaccatttaaacattaagaaattaga |
27729792 |
T |
|
| Q |
108 |
aaatgggttaattata |
123 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
27729793 |
aaatgggttaattata |
27729808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 3e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 3e-20
Query Start/End: Original strand, 9 - 68
Target Start/End: Original strand, 12521329 - 12521388
Alignment:
| Q |
9 |
ataacacttgttgtcttggccacatatcctttgataataagtggtcacattgktgaggta |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
12521329 |
ataacacttgttgtcttggccacatatcctttgataattagtggtcacattagtgaggta |
12521388 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University