View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5860-4 (Length: 139)
Name: Solexa-NF5860-4
Description: NF5860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5860-4 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 1e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 1e-63
Query Start/End: Original strand, 1 - 139
Target Start/End: Complemental strand, 6261040 - 6260903
Alignment:
| Q |
1 |
atcaaatcaccatactactcggggagaaatatggaacacacccttccggaaataatgtagagcttttactacaatcggtctgccaactgaggaaatcgtt |
100 |
Q |
| |
|
||||||||||||||||| | ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6261040 |
atcaaatcaccatactatttggg-agaaatatggaacacacccttccggaaataatgtagagcttttactacaatcggtctgccaactgaggaaatcgtt |
6260942 |
T |
 |
| Q |
101 |
gaagaagccatgtcacactctttataattgcctgcatgt |
139 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6260941 |
gaagaagccatgtcacactctttataattgcctgcatgt |
6260903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University