View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5860-7 (Length: 129)
Name: Solexa-NF5860-7
Description: NF5860
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5860-7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 8e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 8e-65
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 38400420 - 38400292
Alignment:
| Q |
1 |
cataggtgaagccttgtaaacaagaaaatgaataaaccgatggttttactcgtcatactctgactcctcatcggtttcttcatattcgccgctttcctgc |
100 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38400420 |
cataggtgaagccttgtaaataagaaaatgaataaaccgatggttttactcgtcatactctgactcctcatcggtttcttcatattcgccgctttcctgc |
38400321 |
T |
 |
| Q |
101 |
aaagcatcagaaaacaaattgtatattta |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
38400320 |
aaagcatcagaaaacaaattgtatattta |
38400292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University