View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5861-10 (Length: 146)
Name: Solexa-NF5861-10
Description: NF5861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5861-10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 7e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 7e-38
Query Start/End: Original strand, 7 - 86
Target Start/End: Complemental strand, 25164084 - 25164005
Alignment:
| Q |
7 |
atgaaacacgatgaaataatgctccaatttgataatcttcactgtcccaattctgacaatgatagatacctacaccgatg |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25164084 |
atgaaacacgatgaaataatgctccaatttgataatcttcactgtcccaattctgacaatgatagatacctacaccgatg |
25164005 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 5e-17
Query Start/End: Original strand, 7 - 59
Target Start/End: Complemental strand, 25163319 - 25163267
Alignment:
| Q |
7 |
atgaaacacgatgaaataatgctccaatttgataatcttcactgtcccaattc |
59 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25163319 |
atgaaacacgatgaaataatgctccaatttgataatctttcctgtcccaattc |
25163267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University