View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5861-13 (Length: 137)
Name: Solexa-NF5861-13
Description: NF5861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5861-13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 82; Significance: 4e-39; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 7 - 133
Target Start/End: Original strand, 43383484 - 43383610
Alignment:
| Q |
7 |
acttgctaattcaaatccaaagaacaagaaagca---gcaaaatcaacaacaacggtgatggtcgatgagaatgatcagtttgtgtgttcatgttgtaac |
103 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
43383484 |
actttctaattcaaatccaaagaacaagaaagcaaaagcaaaagcaacaacaacggtg---gtcgatgaggatgatcagtttgtgtgttcgtgttgtaac |
43383580 |
T |
|
| Q |
104 |
aaagtatttggatcccatcaggcacgtgga |
133 |
Q |
| |
|
||||||||||||||||||||||||| |||| |
|
|
| T |
43383581 |
aaagtatttggatcccatcaggcacttgga |
43383610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 48 - 133
Target Start/End: Original strand, 25870258 - 25870340
Alignment:
| Q |
48 |
caacaacaacggtgatggtcgatgagaatgatcagtttgtgtgttcatgttgtaacaaagtatttggatcccatcaggcacgtgga |
133 |
Q |
| |
|
|||||||||||||| ||| |||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
25870258 |
caacaacaacggtggtggatgatgag---gatcagtttgtgtgttcgtgttgcaacaaagtatttggatcccatcaggcacttgga |
25870340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 7 - 36
Target Start/End: Original strand, 25870208 - 25870237
Alignment:
| Q |
7 |
acttgctaattcaaatccaaagaacaagaa |
36 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25870208 |
acttgctaattcaaatccaaagaacaagaa |
25870237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University