View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5861-14 (Length: 137)
Name: Solexa-NF5861-14
Description: NF5861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5861-14 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 119; Significance: 3e-61; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 119; E-Value: 3e-61
Query Start/End: Original strand, 8 - 137
Target Start/End: Original strand, 5045419 - 5045549
Alignment:
| Q |
8 |
aaaatttgtcgtatccgtcagatggagtggacggtgtttgtgcgtcattcttatcagaaaata-tcagtgtgtagatgtgttggctgttcttggttgctc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5045419 |
aaaatttgtcgtatccgtcagatggagtggacggtgtttgtgcgtcattcttatcagaaaaaaatcagtgtgtagatgtgttggctgttcttggttgctc |
5045518 |
T |
|
| Q |
107 |
cttgcatacaaatatttgtttttatgaatct |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5045519 |
cttgcatacaaatatttgtttttatgaatct |
5045549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 37; Significance: 0.000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 47 - 133
Target Start/End: Original strand, 15814688 - 15814776
Alignment:
| Q |
47 |
gtgcgtcattcttatca-gaaa-atatcagtgtgtagatgtgttggctgttcttggttgctccttgcatacaaatatttgtttttatga |
133 |
Q |
| |
|
|||||||| |||||||| |||| | ||||||||| ||||| || |||| |||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
15814688 |
gtgcgtcactcttatcaagaaacaaatcagtgtgcagatgctttagctgatcttggatgttccttgcatacaaatatttgtttttatga |
15814776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 105 - 133
Target Start/End: Original strand, 20378497 - 20378525
Alignment:
| Q |
105 |
tccttgcatacaaatatttgtttttatga |
133 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
20378497 |
tccttgcatacaaatatttgtttttatga |
20378525 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University