View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5861-15 (Length: 134)
Name: Solexa-NF5861-15
Description: NF5861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5861-15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 1e-20; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 1e-20
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 40909497 - 40909443
Alignment:
| Q |
1 |
cagagacgatgacagccataaaagttcatttaaggaggagtgggtactcattgta |
55 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40909497 |
cagagacgatgacagccataaaagttcatttaaggaggagtgagtactcattgta |
40909443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 69 - 134
Target Start/End: Complemental strand, 40909446 - 40909381
Alignment:
| Q |
69 |
tgtagatttaataccctttgcacttccatcgacttttattcaataaaagttatatttgctattaaa |
134 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| |||||||| ||||||||| | ||||| |||||| |
|
|
| T |
40909446 |
tgtagatttagtaccctttgcacttctatcgtcttttatttgataaaagttctctttgcaattaaa |
40909381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University