View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5861-18 (Length: 127)
Name: Solexa-NF5861-18
Description: NF5861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5861-18 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 88; Significance: 1e-42; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 88; E-Value: 1e-42
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 32804784 - 32804665
Alignment:
| Q |
8 |
aaaggaaccgtagcagccatggttcctagaagtgagagcgaagttgtatatttaggagttctttcgggaggttctggaagcagttttggttgtggtgtta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |||| ||||||||| |
|
|
| T |
32804784 |
aaaggaaccgtagcagccatggttcctagaagtgagagtgaagttgtatatttaggagttctttctggaggttctggaagttgtgctggtggtggtgtta |
32804685 |
T |
|
| Q |
108 |
gaatgttcgtatgtaattac |
127 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
32804684 |
gaatgttcgtatctaattac |
32804665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University