View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5861-20 (Length: 123)
Name: Solexa-NF5861-20
Description: NF5861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5861-20 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 5 - 123
Target Start/End: Original strand, 32804263 - 32804381
Alignment:
| Q |
5 |
gaagaagaagatgaaagacgaagcaagaaagagtaacgacgccattgttgaacttgaaatttagcgggaaatgaaagattgttgaagaaatcgtttactc |
104 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32804263 |
gaagaagatgatgaaagacgaagcaagaaagagtaacgacgccattgttgaacttgaaatttagcgggaaatgaaagattgttgaagaaatcgtttactc |
32804362 |
T |
|
| Q |
105 |
cttttcacttaaaaagaca |
123 |
Q |
| |
|
||||||| ||||||||||| |
|
|
| T |
32804363 |
cttttcatttaaaaagaca |
32804381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 49; Significance: 2e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 5 - 84
Target Start/End: Original strand, 49029077 - 49029157
Alignment:
| Q |
5 |
gaagaagaagatgaaagacgaagcaagaaagagtaacgacgccattgtt-gaacttgaaatttagcgggaaatgaaagatt |
84 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| | |||||||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
49029077 |
gaagaagataatgaaagacgaagcaagaaagagtgaagacgccattgttggagcttgagatttagcgggaaatgaaagatt |
49029157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University