View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5861-3 (Length: 171)
Name: Solexa-NF5861-3
Description: NF5861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5861-3 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 147; Significance: 8e-78; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 147; E-Value: 8e-78
Query Start/End: Original strand, 8 - 170
Target Start/End: Complemental strand, 1459854 - 1459692
Alignment:
| Q |
8 |
cagtgaactttttatgggttctggattttgtaattatctcataagattacccgcactcaaaaccctacatctgaaagtcattgagtttcatcaatatgga |
107 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||| ||||||||| |
|
|
| T |
1459854 |
cagtgaactttttatgggttctgggttttgtaattatctcataagattaccctcactcaaaaccctacatctgaaagacattgagtttcaacaatatgga |
1459755 |
T |
|
| Q |
108 |
gatcttgattgtcttctagagggatgtccagttcttgaagatcttcaactatatgatatatcc |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1459754 |
gatcttgattgtcttctagagggatgtccagttcttgaagatcttcaactatatgatatatcc |
1459692 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 15 - 170
Target Start/End: Complemental strand, 1446444 - 1446289
Alignment:
| Q |
15 |
ctttttatgggttctggattttgtaattatctcataagattacccgcactcaaaaccctacatctgaaagtcattgagtttcatcaatatggagatcttg |
114 |
Q |
| |
|
|||| ||||||| | | ||||||| |||||| ||||| |||||| ||||||||||||||||| |||||| |||| ||||| ||| ||||||||||||| |
|
|
| T |
1446444 |
ctttatatgggtccggcattttgttattatcccataatattaccttcactcaaaaccctacatttgaaagacattaagtttgatcgatatggagatctta |
1446345 |
T |
|
| Q |
115 |
attgtcttctagagggatgtccagttcttgaagatcttcaactatatgatatatcc |
170 |
Q |
| |
|
| |||||||||| | ||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
1446344 |
agtgtcttctagggtattgtccagttattgaagatcttcaactatatcatatatcc |
1446289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 37; Significance: 0.000000000004; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 120 - 168
Target Start/End: Complemental strand, 975166 - 975118
Alignment:
| Q |
120 |
cttctagagggatgtccagttcttgaagatcttcaactatatgatatat |
168 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
975166 |
cttctagatggatgtccagttcttgaagatcttcaactatgttatatat |
975118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.00000006
Query Start/End: Original strand, 120 - 157
Target Start/End: Original strand, 409673 - 409710
Alignment:
| Q |
120 |
cttctagagggatgtccagttcttgaagatcttcaact |
157 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
409673 |
cttctagatggatgtccagttcttcaagatcttcaact |
409710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 120 - 159
Target Start/End: Original strand, 820790 - 820829
Alignment:
| Q |
120 |
cttctagagggatgtccagttcttgaagatcttcaactat |
159 |
Q |
| |
|
|||||||| | |||||||||||| |||||||||||||||| |
|
|
| T |
820790 |
cttctagacgcatgtccagttctagaagatcttcaactat |
820829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 28; E-Value: 0.0000009
Query Start/End: Original strand, 124 - 159
Target Start/End: Complemental strand, 965896 - 965861
Alignment:
| Q |
124 |
tagagggatgtccagttcttgaagatcttcaactat |
159 |
Q |
| |
|
|||| |||||||||||||||||||| |||||||||| |
|
|
| T |
965896 |
tagatggatgtccagttcttgaagaccttcaactat |
965861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University