View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5861-6 (Length: 151)
Name: Solexa-NF5861-6
Description: NF5861
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5861-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 5 - 151
Target Start/End: Complemental strand, 4075557 - 4075411
Alignment:
| Q |
5 |
agcaaagggtgaaaattgttacaaagaaagagatcaaattacagaagatggatatagtggaaatggttctgttcctaaaatgatgcaagtggttgaaaat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4075557 |
agcaaagggtgaaaattgttacaaagaaagagatcaaattaaagaagagggatatagtggaaatggttctgttcctaaaatgatgcaagtggtggaaaat |
4075458 |
T |
|
| Q |
105 |
gttctagaagatttgaaaactagaggtttgaatgttcaattgcttaa |
151 |
Q |
| |
|
|||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
4075457 |
gttctacaagatttgaaaagaagaggtttgaatgttcaattgcttaa |
4075411 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 78 - 151
Target Start/End: Original strand, 25824676 - 25824749
Alignment:
| Q |
78 |
cctaaaatgatgcaagtggttgaaaatgttctagaagatttgaaaactagaggtttgaatgttcaattgcttaa |
151 |
Q |
| |
|
|||||||||||||||||||| || || || || || ||||||||||| | |||||| ||||||||| ||||||| |
|
|
| T |
25824676 |
cctaaaatgatgcaagtggtggagaaggtgcttgatgatttgaaaacaaaaggtttaaatgttcaaatgcttaa |
25824749 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University