View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5862-1 (Length: 204)
Name: Solexa-NF5862-1
Description: NF5862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5862-1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 91; Significance: 1e-44; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 91; E-Value: 1e-44
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 52274314 - 52274203
Alignment:
| Q |
1 |
gtggaacaatcgattttattaagtttgtaggtcattgcagtctgacccaaaaawgtgyagaagcagagacccgtatacctagctaaattaacatgtgcaa |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| | | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52274314 |
gtggaacaatcaattttattaagtttgtaggtcattgcagtctgacccaaaaaagtgtaaa--cagagacccgtatacctagctaaattaacatgtgcaa |
52274217 |
T |
 |
| Q |
101 |
aattaaattaaatt |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
52274216 |
aattaaattaaatt |
52274203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 163 - 204
Target Start/End: Complemental strand, 52274153 - 52274110
Alignment:
| Q |
163 |
gtatggcgcgttt--atagaattttcaaacaaatttaccgccat |
204 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52274153 |
gtatggcgcgtttttatagaattttcaaacaaatttaccgccat |
52274110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University