View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5862-11 (Length: 127)
Name: Solexa-NF5862-11
Description: NF5862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5862-11 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 8e-62; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 8e-62
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 31078388 - 31078507
Alignment:
| Q |
8 |
ggaagtggagttttattgggatggatccttatagttatgcggtttttcaagctgggccgagggtgtgtttaggaaaggaaatggcgttcttgcagatgaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31078388 |
ggaagtggagttttattgggatggatccttatagttatgcggtttttcaagctgggccgagggtgtgtttaggaaaggaaatggcgttcttgcagatgaa |
31078487 |
T |
|
| Q |
108 |
gagggtggttgcagggatca |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
31078488 |
gagggtggttgcagggatca |
31078507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 98; E-Value: 1e-48
Query Start/End: Original strand, 10 - 127
Target Start/End: Original strand, 31127708 - 31127825
Alignment:
| Q |
10 |
aagtggagttttattgggatggatccttatagttatgcggtttttcaagctgggccgagggtgtgtttaggaaaggaaatggcgttcttgcagatgaaga |
109 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
31127708 |
aagtggagctttattgggatggatccttatagttatgcggtttttcaggctgggccaagggtgtgtttaggaaaggaaatggcgttcttgcagatgaaaa |
31127807 |
T |
|
| Q |
110 |
gggtggttgcagggatca |
127 |
Q |
| |
|
|||||||||| ||||||| |
|
|
| T |
31127808 |
gggtggttgccgggatca |
31127825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 58; E-Value: 8e-25
Query Start/End: Original strand, 13 - 98
Target Start/End: Original strand, 31132419 - 31132504
Alignment:
| Q |
13 |
tggagttttattgggatggatccttatagttatgcggtttttcaagctgggccgagggtgtgtttaggaaaggaaatggcgttctt |
98 |
Q |
| |
|
||||| ||| |||||||||||||||||| |||| || ||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
31132419 |
tggagctttgttgggatggatccttatacttatccgatttttcaagctgggccgagggtgtgtttagggaaagaaatggcgttctt |
31132504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University