View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5862-12 (Length: 127)
Name: Solexa-NF5862-12
Description: NF5862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5862-12 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 116; Significance: 2e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 2e-59
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 16131257 - 16131138
Alignment:
| Q |
8 |
tgagtttcataatatgatcataatctacacaaagcataagataactgatggtcaacttccttaatgtggaaattgagagactaatctggtttatgtgctc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16131257 |
tgagtttcataatatgatcataatctacacaaagcataagataactgatggtcaacttccttaatgtggaaattgagagactaatctggtttatgtgctc |
16131158 |
T |
|
| Q |
108 |
ccaatagcaattatccaact |
127 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
16131157 |
ccaataacaattatccaact |
16131138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 59 - 119
Target Start/End: Original strand, 31268552 - 31268612
Alignment:
| Q |
59 |
tcaacttccttaatgtggaaattgagagactaatctggtttatgtgctcccaatagcaatt |
119 |
Q |
| |
|
||||||||| |||||||||||||| | ||| ||||| ||||||| ||||||||| ||||| |
|
|
| T |
31268552 |
tcaacttccgtaatgtggaaattgcaacactgatctgctttatgttctcccaataacaatt |
31268612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University