View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5862-15 (Length: 122)
Name: Solexa-NF5862-15
Description: NF5862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5862-15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 100; Significance: 6e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 100; E-Value: 6e-50
Query Start/End: Original strand, 8 - 119
Target Start/End: Original strand, 22042867 - 22042978
Alignment:
| Q |
8 |
tgtttgcccggccctgtattcggagacatggtaggtccaactatgttcttctatcctatatcaactaagtacatatttagttttgttttgtttttccaca |
107 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22042867 |
tgtttgcgcggccctgtattcggagacatggtagctccaactatgttcttgtatcctatatcaactaagtacatatttagttttgttttgtttttccaca |
22042966 |
T |
 |
| Q |
108 |
aattagtttcat |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22042967 |
aattagtttcat |
22042978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 96; Significance: 2e-47; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 96; E-Value: 2e-47
Query Start/End: Original strand, 8 - 119
Target Start/End: Complemental strand, 2424552 - 2424441
Alignment:
| Q |
8 |
tgtttgcccggccctgtattcggagacatggtaggtccaactatgttcttctatcctatatcaactaagtacatatttagttttgttttgtttttccaca |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2424552 |
tgtttgcccggccctgtatttggagacatggtagctccaactatgttcttgtatcctatatcaactaagtacatatttagttttgctttgtttttccaca |
2424453 |
T |
 |
| Q |
108 |
aattagtttcat |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
2424452 |
aattagtttcat |
2424441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University