View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5862-5 (Length: 146)
Name: Solexa-NF5862-5
Description: NF5862
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5862-5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 7 - 143
Target Start/End: Original strand, 9115847 - 9115983
Alignment:
| Q |
7 |
aagaaataaacgacagtgataatactgatttagatagagcaagaattatgcttctgaaggaaaaagactattgtcataagttggcttcacggagtaatag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9115847 |
aagaaataaacgacagtgataatactgatttagatagaacaagaattatgcttctgaaggaaaaagactattgtcataagttggcttcacggagtaatag |
9115946 |
T |
|
| Q |
107 |
tgtactacactaatactaaacatttctccagtttaaa |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9115947 |
tgtactacactaatactaaacatttctccagtttaaa |
9115983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University