View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-10 (Length: 140)
Name: Solexa-NF5863-10
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-10 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 103; Significance: 1e-51; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 103; E-Value: 1e-51
Query Start/End: Original strand, 10 - 139
Target Start/End: Complemental strand, 46919177 - 46919047
Alignment:
| Q |
10 |
atctgaccttcaagctttgaaagcttttaatattattgttggcaaccttggtcattgtcctaaagttatagaggttatttggtctctttttcccatgggt |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46919177 |
atctgaccttcaagctttgaaagcttttaatatt---gttggcaaccttggtcattgtcctaaagttatagaggttatttggtctctttttcccatgggt |
46919081 |
T |
|
| Q |
110 |
tgggtcaa----aataatgatggtgcagctagag |
139 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |
|
|
| T |
46919080 |
tgggtcaaaattaataatgatggtgcagctagag |
46919047 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University