View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-18 (Length: 132)
Name: Solexa-NF5863-18
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-18 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 82; Significance: 4e-39; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 5 - 102
Target Start/End: Complemental strand, 4059388 - 4059291
Alignment:
| Q |
5 |
atagacggtgaaatggtgagtagaacaataggaatgtctaaattcccacttttgcatcatataggaatggatgcgttcgggcatcgagggattcaatt |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | |||||||||||||||||||||||| |
|
|
| T |
4059388 |
atagacggtgaaatggtgagtagaacaataggaatgtctaaattcccacttttgcatcatataggaacgggcgggttcgggcatcgagggattcaatt |
4059291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University