View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: Solexa-NF5863-2 (Length: 238)

Name: Solexa-NF5863-2
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] Solexa-NF5863-2
Solexa-NF5863-2
[»] chr2 (2 HSPs)
chr2 (141-238)||(946424-946521)
chr2 (8-54)||(946607-946653)


Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 141 - 238
Target Start/End: Complemental strand, 946521 - 946424
Alignment:
141 accccatcttagtgaaaagaaaaagtatcgtagcaacaaaatctctatatagcatgtatgtgttattagattgcttttaagagatgcaagagtttgta 238  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
946521 accccatcttagtgaaaagaaaaagtatcgtagcaacaaaatctctatatagcatgtatgtgtgattagattgcttttaagagatgcaagagtttgta 946424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 54
Target Start/End: Complemental strand, 946653 - 946607
Alignment:
8 caaaattccttcaacaacgtatgtgtttatcgtcgtcgttgatacca 54  Q
    ||||||||||||||||||||||||||||||||||||| |||||||||    
946653 caaaattccttcaacaacgtatgtgtttatcgtcgtctttgatacca 946607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University