View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-2 (Length: 238)
Name: Solexa-NF5863-2
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-2 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 141 - 238
Target Start/End: Complemental strand, 946521 - 946424
Alignment:
| Q |
141 |
accccatcttagtgaaaagaaaaagtatcgtagcaacaaaatctctatatagcatgtatgtgttattagattgcttttaagagatgcaagagtttgta |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
946521 |
accccatcttagtgaaaagaaaaagtatcgtagcaacaaaatctctatatagcatgtatgtgtgattagattgcttttaagagatgcaagagtttgta |
946424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 8 - 54
Target Start/End: Complemental strand, 946653 - 946607
Alignment:
| Q |
8 |
caaaattccttcaacaacgtatgtgtttatcgtcgtcgttgatacca |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
946653 |
caaaattccttcaacaacgtatgtgtttatcgtcgtctttgatacca |
946607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University