View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-21 (Length: 126)
Name: Solexa-NF5863-21
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-21 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 2e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 2e-65
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 16395914 - 16395789
Alignment:
| Q |
1 |
ggatctttgtctaaagttttaacacttgatgtatctctctacttttcaggattgctgtgtacaaagccctctatagactatttggagggtttgttgcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16395914 |
ggatctttgtctaaagttttaacacttgatgtatctctctacttttcaggattgctgtgtacaaagccctctatagactatttggagggtttgttgcaga |
16395815 |
T |
 |
| Q |
101 |
tgtagttgctgcacttgatcaggtat |
126 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
16395814 |
tgtagttgctgcacttgatcaggtat |
16395789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 8e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 8e-25
Query Start/End: Original strand, 45 - 126
Target Start/End: Original strand, 52926629 - 52926710
Alignment:
| Q |
45 |
ttcaggattgctgtgtacaaagccctctatagactatttggagggtttgttgcagatgtagttgctgcacttgatcaggtat |
126 |
Q |
| |
|
|||||||||||||| ||||| || ||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
52926629 |
ttcaggattgctgtatacaaggcactctatagactctttggagggtttgttgcagatgtagttgccgcaattgatcaggtat |
52926710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University