View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-23 (Length: 105)
Name: Solexa-NF5863-23
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-23 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 96; Significance: 1e-47; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 96; E-Value: 1e-47
Query Start/End: Original strand, 10 - 105
Target Start/End: Complemental strand, 43260644 - 43260549
Alignment:
| Q |
10 |
aattcctttgtagttgaagaaaaaagtattgtaaggtggatgttttttgagtaagatttaagaacctagagtatgcctaagtaaaacgttttgatc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43260644 |
aattcctttgtagttgaagaaaaaagtattgtaaggtggatgttttttgagtaagatttaagaacctagagtatgcctaagtaaaacgttttgatc |
43260549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 6e-22
Query Start/End: Original strand, 10 - 94
Target Start/End: Complemental strand, 43257043 - 43256959
Alignment:
| Q |
10 |
aattcctttgtagttgaagaaaaaagtattgtaaggtggatgttttttgagtaagatttaagaacctagagtatgcctaagtaaa |
94 |
Q |
| |
|
||||||| ||||||||| |||||| | |||||||||||||||||| ||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
43257043 |
aattcctaagtagttgaacaaaaaactgttgtaaggtggatgttttgtgagtaagatttaagaatcttgagtatgcctaagtaaa |
43256959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University