View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-26 (Length: 96)
Name: Solexa-NF5863-26
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-26 |
 |  |
|
| [»] chr2 (3 HSPs) |
 |  |
|
| [»] chr4 (5 HSPs) |
 |  |
|
| [»] chr7 (5 HSPs) |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
| [»] chr1 (5 HSPs) |
 |  |
|
| [»] scaffold0258 (1 HSPs) |
 |  |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
| [»] chr3 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 9e-27; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 9e-27
Query Start/End: Original strand, 8 - 96
Target Start/End: Complemental strand, 35010607 - 35010519
Alignment:
| Q |
8 |
ccacccgcattcgcagagtctgagaaggggtccctgnnnnnnnnatacaagagactgttttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35010607 |
ccactcgcattcgcagagtctgagaaggggtccctgttttttttatacaagagactgttttcagtcacatgacaacaactttaccgttg |
35010519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 66 - 96
Target Start/End: Original strand, 21377206 - 21377236
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
21377206 |
tttcagtcacatgacaacaactttaccgttg |
21377236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 65 - 92
Target Start/End: Original strand, 24200757 - 24200784
Alignment:
| Q |
65 |
ttttcagtcacatgacaacaactttacc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
24200757 |
ttttcagtcacatgacaacaactttacc |
24200784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000002; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000002
Query Start/End: Original strand, 65 - 96
Target Start/End: Original strand, 20908770 - 20908801
Alignment:
| Q |
65 |
ttttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20908770 |
ttttcagtcacatgacaacaactttaccgttg |
20908801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 66 - 96
Target Start/End: Complemental strand, 54967023 - 54966993
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
54967023 |
tttcagtcacatgacaacaactttaccgttg |
54966993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000003
Query Start/End: Original strand, 66 - 95
Target Start/End: Original strand, 487268 - 487297
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccgtt |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
487268 |
tttcagtcacatgacaacaactttaccgtt |
487297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 93
Target Start/End: Original strand, 17315431 - 17315458
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
17315431 |
tttcagtcacatgacaacaactttaccg |
17315458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 65 - 96
Target Start/End: Original strand, 35894586 - 35894617
Alignment:
| Q |
65 |
ttttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |
|
|
| T |
35894586 |
ttttcagtcacaggacaacaactttaccgttg |
35894617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.000000007; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 66 - 96
Target Start/End: Original strand, 3469312 - 3469342
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
3469312 |
tttcagtcacatgacaacaactttaccgttg |
3469342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 66 - 96
Target Start/End: Complemental strand, 19266452 - 19266422
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19266452 |
tttcagtcacatgacaacaactttaccgttg |
19266422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 66 - 94
Target Start/End: Original strand, 14099139 - 14099167
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccgt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14099139 |
tttcagtcacatgacaacaactttaccgt |
14099167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 66 - 94
Target Start/End: Original strand, 14409156 - 14409184
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccgt |
94 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
14409156 |
tttcagtcacatgacaacaactttaccgt |
14409184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 65 - 92
Target Start/End: Original strand, 14732954 - 14732981
Alignment:
| Q |
65 |
ttttcagtcacatgacaacaactttacc |
92 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
14732954 |
ttttcagtcacatgacaacaactttacc |
14732981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 31; Significance: 0.000000007; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 66 - 96
Target Start/End: Original strand, 13905112 - 13905142
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13905112 |
tttcagtcacatgacaacaactttaccgttg |
13905142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 93
Target Start/End: Complemental strand, 9161125 - 9161098
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
9161125 |
tttcagtcacatgacaacaactttaccg |
9161098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 31; Significance: 0.000000007; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 66 - 96
Target Start/End: Original strand, 18724678 - 18724708
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
18724678 |
tttcagtcacatgacaacaactttaccgttg |
18724708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.000000007
Query Start/End: Original strand, 66 - 96
Target Start/End: Complemental strand, 52910242 - 52910212
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
52910242 |
tttcagtcacatgacaacaactttaccgttg |
52910212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 93
Target Start/End: Complemental strand, 14617063 - 14617036
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
14617063 |
tttcagtcacatgacaacaactttaccg |
14617036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 65 - 96
Target Start/End: Original strand, 28894663 - 28894694
Alignment:
| Q |
65 |
ttttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
||||||||||||||||||||||||||| |||| |
|
|
| T |
28894663 |
ttttcagtcacatgacaacaactttactgttg |
28894694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 93
Target Start/End: Complemental strand, 33223009 - 33222982
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33223009 |
tttcagtcacatgacaacaactttaccg |
33222982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0258 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: scaffold0258
Description:
Target: scaffold0258; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 93
Target Start/End: Original strand, 13156 - 13183
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
13156 |
tttcagtcacatgacaacaactttaccg |
13183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 28; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 69 - 96
Target Start/End: Complemental strand, 23974779 - 23974752
Alignment:
| Q |
69 |
cagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
23974779 |
cagtcacatgacaacaactttaccgttg |
23974752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 28; Significance: 0.0000004; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 69 - 96
Target Start/End: Complemental strand, 22609787 - 22609760
Alignment:
| Q |
69 |
cagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
22609787 |
cagtcacatgacaacaactttaccgttg |
22609760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 65 - 96
Target Start/End: Complemental strand, 28904968 - 28904937
Alignment:
| Q |
65 |
ttttcagtcacatgacaacaactttaccgttg |
96 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |
|
|
| T |
28904968 |
tttttagtcacatgacaacaactttaccgttg |
28904937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 28; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 93
Target Start/End: Complemental strand, 53062062 - 53062035
Alignment:
| Q |
66 |
tttcagtcacatgacaacaactttaccg |
93 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
53062062 |
tttcagtcacatgacaacaactttaccg |
53062035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University