View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-3 (Length: 231)
Name: Solexa-NF5863-3
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-3 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 64 - 231
Target Start/End: Complemental strand, 9231762 - 9231595
Alignment:
| Q |
64 |
tttagtagttcttatgaaaaagcactttgagggtttgttttttcttgttttgagtgatttgtgaaagagatctttgagaaagctatataggtgaatgatg |
163 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9231762 |
tttagtagttcttatgaagaagcactttgagggtttgttttttcttgttttgagtgatttgtgaaagagatctttgagaaagctatataggtgaatgatg |
9231663 |
T |
 |
| Q |
164 |
tttttaagagacaaatagagaaagcttcatggggtgggaaaatgtaatgatggtagtgatggtctgtg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9231662 |
tttttaagagacaaatagagaaagcttcatggggtgggaaaatgtaatgatggtagtgatggtttgtg |
9231595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University