View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-31 (Length: 77)
Name: Solexa-NF5863-31
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 28; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 28; E-Value: 0.0000003
Query Start/End: Original strand, 41 - 68
Target Start/End: Complemental strand, 39200312 - 39200285
Alignment:
| Q |
41 |
ttctcactttactctccaaaatgcaaaa |
68 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
39200312 |
ttctcactttactctccaaaatgcaaaa |
39200285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University