View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-34 (Length: 58)
Name: Solexa-NF5863-34
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-34 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 47; Significance: 1e-18; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 8 - 58
Target Start/End: Original strand, 4536707 - 4536757
Alignment:
| Q |
8 |
gttaccccaattgaattgccctcacttatgcataggcattattgtgtgatc |
58 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4536707 |
gttaccccaattgaattgccctcacttatccataggcattattgtgtgatc |
4536757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University