View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-36 (Length: 47)
Name: Solexa-NF5863-36
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-36 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 35; Significance: 0.00000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000001
Query Start/End: Original strand, 8 - 46
Target Start/End: Complemental strand, 34461539 - 34461501
Alignment:
| Q |
8 |
gaactctattgctctttcttgacacatcttatgatgaga |
46 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34461539 |
gaactctattgctcttttttgacacatcttatgatgaga |
34461501 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 32; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 32; E-Value: 0.0000000007
Query Start/End: Original strand, 8 - 47
Target Start/End: Original strand, 448852 - 448891
Alignment:
| Q |
8 |
gaactctattgctctttcttgacacatcttatgatgagag |
47 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
448852 |
gaactctattgctctttcttgacacatcttgtgttgagag |
448891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 37
Target Start/End: Complemental strand, 42477671 - 42477642
Alignment:
| Q |
8 |
gaactctattgctctttcttgacacatctt |
37 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
42477671 |
gaactctattgctctttcttgacacatctt |
42477642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University