View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-4 (Length: 216)
Name: Solexa-NF5863-4
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-4 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0041 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 216
Target Start/End: Complemental strand, 70279 - 70070
Alignment:
| Q |
7 |
agatttgaggtcacattcacttatggtaccagtccactattgcccttatctcttgttgaatgagaaacttttttaccgggtcattagaatcattgaattc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
70279 |
agatttgaggtcacattcacttatggtaccagtccactattgcccttatctcttgttgaatgagaaacttttttaccgggtcatgagaatcattgaattc |
70180 |
T |
|
| Q |
107 |
caccacctgaaaaattgattatgtgtgtggtgagtcttgatactcgtgatataaaccaatacaactctcactctgcatcctctccaccctttccacttgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
70179 |
caccacctgaaaaattgattatgtgtgtggtgagtcttgatactcgtgatataaaccaatacaactctcactctgcatcctctccaccctttccacttgt |
70080 |
T |
|
| Q |
207 |
tttgctctgt |
216 |
Q |
| |
|
|||||||||| |
|
|
| T |
70079 |
tttgctctgt |
70070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 7 - 216
Target Start/End: Original strand, 40896005 - 40896214
Alignment:
| Q |
7 |
agatttgaggtcacattcacttatggtaccagtccactattgcccttatctcttgttgaatgagaaacttttttaccgggtcattagaatcattgaattc |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
40896005 |
agatttgaggtcacattcacttatggtaccagtccactattgcccttatctcttgttgaatgagaaacttttttaccgggtcatgagaatcattgaattc |
40896104 |
T |
|
| Q |
107 |
caccacctgaaaaattgattatgtgtgtggtgagtcttgatactcgtgatataaaccaatacaactctcactctgcatcctctccaccctttccacttgt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40896105 |
caccacctgaaaaattgattatgtgtgtggtgagtcttgatactcgtgatataaaccaatacaactctcactctgcatcctctccaccctttccacttgt |
40896204 |
T |
|
| Q |
207 |
tttgctctgt |
216 |
Q |
| |
|
|||||||||| |
|
|
| T |
40896205 |
tttgctctgt |
40896214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University