View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-5 (Length: 170)
Name: Solexa-NF5863-5
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 7e-29; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 7e-29
Query Start/End: Original strand, 28 - 92
Target Start/End: Original strand, 39218856 - 39218920
Alignment:
| Q |
28 |
ttaataaatgaggtcaaggtcatatcataaaaaagttgttatttttatcggtggacaacacaaaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39218856 |
ttaataaatgaggtcaaggtcatatcataaaaaagttgttatttttatcggtggacaacacaaaa |
39218920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 89 - 166
Target Start/End: Complemental strand, 5974823 - 5974745
Alignment:
| Q |
89 |
aaaatacgattgacaaatcacggtgtatacgatgctt-ggaattgtcacatgtggaattcatgacttaaggttaaacac |
166 |
Q |
| |
|
||||||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5974823 |
aaaatacgattgataaatcatggtgtatacgatgctttggaattgtcacatgtggaattcatgacttaaggttaaacac |
5974745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University