View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-6 (Length: 169)
Name: Solexa-NF5863-6
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-6 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 9e-84; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 9e-84
Query Start/End: Original strand, 9 - 169
Target Start/End: Complemental strand, 52927578 - 52927418
Alignment:
| Q |
9 |
gaatcccaggaaggccagcagggacaggatcaaattttgcaccaggggaaatattttcaacacagagaacaaatccagctgcaccaagggcctttgccgt |
108 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52927578 |
gaatcccaggaaggccaacagggacaggatcaaattttgcaccaggggaaatattttcaacacagagaacaaatccagctgcaccaagggcctttgccgt |
52927479 |
T |
|
| Q |
109 |
ttctgatactttcttcattgatgcagtaccaacaacaaagttgaaagaatatccgcagaga |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52927478 |
ttctgatactttcttcattgatgcagtaccaacaacaaagttgaaagaatatccgcagaga |
52927418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 81; Significance: 2e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 81; E-Value: 2e-38
Query Start/End: Original strand, 13 - 169
Target Start/End: Original strand, 16393762 - 16393918
Alignment:
| Q |
13 |
cccaggaaggccagcagggacaggatcaaattttgcaccaggggaaatattttcaacacagagaacaaatccagctgcaccaagggcctttgccgtttct |
112 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| | ||||| |||| |||||| ||||| |||||||||||| | || |||||||||||||| |||||| |
|
|
| T |
16393762 |
cccaggaaggccaacagggactggatcaaatttcgttccaggagaaacattttctacacaaagaacaaatccaacagctccaagggcctttgctgtttct |
16393861 |
T |
|
| Q |
113 |
gatactttcttcattgatgcagtaccaacaacaaagttgaaagaatatccgcagaga |
169 |
Q |
| |
|
|| ||||||||||| ||||| |||||||||||||||||| ||||||| || |||||| |
|
|
| T |
16393862 |
gagactttcttcatcgatgctgtaccaacaacaaagttgtaagaatagccacagaga |
16393918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University