View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-7 (Length: 155)
Name: Solexa-NF5863-7
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-7 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 102; Significance: 5e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 102; E-Value: 5e-51
Query Start/End: Original strand, 9 - 155
Target Start/End: Original strand, 946037 - 946183
Alignment:
| Q |
9 |
gagagagatgaatatagaggagagataaacataaagttaaagtgannnnnnnaccttaaacatagtagaatcagatccgttgccacaactcatcatgagg |
108 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| | ||||||| ||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
946037 |
gagagagatcaatatagaggagagataaacataaagttaaagtgatttttctatcttaaacgtagtagaatcaaatccgttgccacaactcatcatgagg |
946136 |
T |
 |
| Q |
109 |
tcaactgcatgaagtgtctttcaatgcgattcttaggatgggaaaca |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||| |
|
|
| T |
946137 |
tcaactgcatgaagtgtctttcaatgcgattcttgggttgggaaaca |
946183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University