View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-8 (Length: 154)
Name: Solexa-NF5863-8
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 29 - 154
Target Start/End: Original strand, 25492157 - 25492282
Alignment:
| Q |
29 |
tcaagtttaaagggggtttgaatatagtaaggatagagaactcttttagccttatggattgtgtcgggtgtctcttttatgtaaagtttgaagtaaataa |
128 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25492157 |
tcaagtttaaagggggtttggatatagtaaggatagagaactcttttagccttatggattgtgtcgggtgtctcttttttgtaaagtttgaagtaaataa |
25492256 |
T |
 |
| Q |
129 |
ttgtcatgaagtgtctggttctccac |
154 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25492257 |
ttgtcatgaagtgtctggttctccac |
25492282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University