View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5863-9 (Length: 151)
Name: Solexa-NF5863-9
Description: NF5863
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5863-9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 24 - 151
Target Start/End: Complemental strand, 38215933 - 38215806
Alignment:
| Q |
24 |
ttgaaggtgaagattgaatatgtgtgttattcagcatcgaaaaatgcagatgcagcagacttcaaatttttgaattttgtgttaaaaattaatttatgtt |
123 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38215933 |
ttgaagttgaagattgaatatgtgtgttattcagcatcgaaaaatgcagttgcagcagacttcaaaattttgaattttgtgttaaaaattaatttatgtt |
38215834 |
T |
 |
| Q |
124 |
tgatcattatataaataaatttgagttg |
151 |
Q |
| |
|
| |||||||||| ||||||||||||||| |
|
|
| T |
38215833 |
tcatcattatattaataaatttgagttg |
38215806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University