View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5864-15 (Length: 70)
Name: Solexa-NF5864-15
Description: NF5864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5864-15 |
 | |
|
| [»] chr3 (8 HSPs) |
| |
|
| [»] chr6 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 63; Significance: 4e-28; HSPs: 8)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 63; E-Value: 4e-28
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 11245566 - 11245504
Alignment:
| Q |
8 |
atactaacatcactgtgctacctgattcaattggtagtttggtgcagttgcgctatcttgatc |
70 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11245566 |
atactaacatcactgtgctacctgattcaattggtagtttggtgcagttgcgctatcttgatc |
11245504 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 51; E-Value: 6e-21
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 11158960 - 11158898
Alignment:
| Q |
8 |
atactaacatcactgtgctacctgattcaattggtagtttggtgcagttgcgctatcttgatc |
70 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
11158960 |
atactaacatcactgtactacctgattcaattggaagtttggtgcagttgcgctatctagatc |
11158898 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 1e-18
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 11129972 - 11129910
Alignment:
| Q |
8 |
atactaacatcactgtgctacctgattcaattggtagtttggtgcagttgcgctatcttgatc |
70 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
11129972 |
atactaacatcgctgtactacctgattcaattggaagtttggtgcagttgcgctatctagatc |
11129910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 10890432 - 10890494
Alignment:
| Q |
8 |
atactaacatcactgtgctacctgattcaattggtagtttggtgcagttgcgctatcttgatc |
70 |
Q |
| |
|
|||| |||||||| |||| || ||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
10890432 |
atacaaacatcacaatgcttccagattcaattggcagtttggtgcagttgcgctatctagatc |
10890494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 70
Target Start/End: Complemental strand, 11147797 - 11147735
Alignment:
| Q |
8 |
atactaacatcactgtgctacctgattcaattggtagtttggtgcagttgcgctatcttgatc |
70 |
Q |
| |
|
|||| |||||||| |||| || ||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
11147797 |
atacaaacatcacaatgcttccagattcaattggcagtttggtgcagttgcgctatctagatc |
11147735 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 31; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 70
Target Start/End: Original strand, 10678580 - 10678626
Alignment:
| Q |
24 |
gctacctgattcaattggtagtttggtgcagttgcgctatcttgatc |
70 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| ||||| |||| |
|
|
| T |
10678580 |
gctacctgattcaattggcaatttggtgcagttgcggtatctagatc |
10678626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 65
Target Start/End: Original strand, 9840003 - 9840044
Alignment:
| Q |
24 |
gctacctgattcaattggtagtttggtgcagttgcgctatct |
65 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
9840003 |
gctacctgattcaattggaaatttggtgcagttgcggtatct |
9840044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 30; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 65
Target Start/End: Original strand, 9850881 - 9850922
Alignment:
| Q |
24 |
gctacctgattcaattggtagtttggtgcagttgcgctatct |
65 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||| ||||| |
|
|
| T |
9850881 |
gctacctgattcaattggaaatttggtgcagttgcggtatct |
9850922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.000000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.000000000005
Query Start/End: Original strand, 23 - 70
Target Start/End: Complemental strand, 31678661 - 31678614
Alignment:
| Q |
23 |
tgctacctgattcaattggtagtttggtgcagttgcgctatcttgatc |
70 |
Q |
| |
|
||||||| ||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
31678661 |
tgctaccggattcaattggcagtttggtgcagttgcggtatcttgatc |
31678614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.00000008; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 65
Target Start/End: Original strand, 827033 - 827085
Alignment:
| Q |
13 |
aacatcactgtgctacctgattcaattggtagtttggtgcagttgcgctatct |
65 |
Q |
| |
|
||||||||| |||| || ||||||||||||| |||||||||| |||| ||||| |
|
|
| T |
827033 |
aacatcactatgctgccagattcaattggtaatttggtgcagctgcggtatct |
827085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University