View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5864-5 (Length: 126)
Name: Solexa-NF5864-5
Description: NF5864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5864-5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 56; Significance: 1e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 1e-23
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 34357173 - 34357118
Alignment:
| Q |
1 |
gtgcactagtttagtttggataggacttgtaatcggtttagactcaatctaatttg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34357173 |
gtgcactagtttagtttggataggacttgtaatcggtttagactcaatctaatttg |
34357118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University