View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5864-9 (Length: 101)
Name: Solexa-NF5864-9
Description: NF5864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5864-9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 94; Significance: 2e-46; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 94; E-Value: 2e-46
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 33269876 - 33269973
Alignment:
| Q |
1 |
tattgtttgttactgcttttgctatgggatagatgatgggccatgacacactaattgggatgaaaattgctcctccctctcagtttttgctcattcct |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33269876 |
tattgtttgttactgcttttgctatgggatagatgatgggacatgacacactaattgggatgaaaattgctcctccctctcagtttttgctcattcct |
33269973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University