View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5865-3 (Length: 146)
Name: Solexa-NF5865-3
Description: NF5865
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5865-3 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 135; Significance: 1e-70; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 135; E-Value: 1e-70
Query Start/End: Original strand, 8 - 146
Target Start/End: Complemental strand, 34958072 - 34957934
Alignment:
| Q |
8 |
attaagacacaaaccatgatttgaaactatattacacaaattgacattcatggaagaagaaaagtttggtaaaatatagcataaatatgggatgaaaaaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34958072 |
attaagacacaaaccatgatttgaaactatattacacaaattgacattcatggaagaagaaaagtttggtaaaatatagcataaatatgggatgaaaaaa |
34957973 |
T |
|
| Q |
108 |
tagatagacccagttcaagaataatttacctcgcagaga |
146 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34957972 |
tagatagacccagttgaagaataatttacctcgcagaga |
34957934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University