View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: Solexa-NF5866-14 (Length: 140)
Name: Solexa-NF5866-14
Description: NF5866
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] Solexa-NF5866-14 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 1e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 1e-66
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 26767977 - 26768116
Alignment:
| Q |
1 |
gagagagatgaaagtgcacgattgaattcacttcacaatattgccttagattttcacattgacatcaactatttatacatcacaaaatagagctatgttt |
100 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26767977 |
gagagatatgaaagtgcacgattgaattcacttcacaatattgacttagattttcacattaacatcaactatttatacatcacaaaatagagctatgttt |
26768076 |
T |
|
| Q |
101 |
ctcaacaactaacggataaatttaagtaactgtcataaca |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26768077 |
ctcaacaactaacggataaatttaagtaactgtcataaca |
26768116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000004
Query Start/End: Original strand, 49 - 90
Target Start/End: Complemental strand, 25640139 - 25640098
Alignment:
| Q |
49 |
gattttcacattgacatcaactatttatacatcacaaaatag |
90 |
Q |
| |
|
|||||||||||| || |||| ||||||||||||||||||||| |
|
|
| T |
25640139 |
gattttcacattcacctcaattatttatacatcacaaaatag |
25640098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University